pAAV_hSyn1_AdoLightG
(Plasmid
#187465)
-
PurposeExpresses green adenosine indicator AdoLightG in neuronal cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187465 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV.hSynapsin1
-
Backbone manufacturerViral Vector Facility - University of Zurich
- Backbone size w/o insert (bp) 4457
- Total vector size (bp) 6464
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAdoLightG
-
SpeciesSynthetic
-
Insert Size (bp)2007
-
GenBank ID
- Promoter human Synapsin-1
-
Tag
/ Fusion Protein
- Flag tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BaHMI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gtaagtatcaaggttacaagacaggtttaagg
- 3′ sequencing primer gccatacgggaagcaatagcatg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_hSyn1_AdoLightG was a gift from Tommaso Patriarchi (Addgene plasmid # 187465 ; http://n2t.net/addgene:187465 ; RRID:Addgene_187465) -
For your References section:
Sensitive multicolor indicators for monitoring norepinephrine in vivo. Kagiampaki Z, Rohner V, Kiss C, Curreli S, Dieter A, Wilhelm M, Harada M, Duss SN, Dernic J, Bhat MA, Zhou X, Ravotto L, Ziebarth T, Wasielewski LM, Sonmez L, Benke D, Weber B, Bohacek J, Reiner A, Wiegert JS, Fellin T, Patriarchi T. Nat Methods. 2023 Sep;20(9):1426-1436. doi: 10.1038/s41592-023-01959-z. 10.1038/s41592-023-01959-z PubMed 37474807