pAAV-hSyn-eGFP-P2A-LgBiT-NLS
(Plasmid #187834)

• Purpose: Expression of eGFP-P2A-LgBiT-NLS from human synapsin promoter via adeno-associated virus for neuronal expression.
• Depositing Lab: William McEwan
• Publication: Tuck et al Cell Rep. 2022 May 3;39(5):110776. doi: 10.1016/j.celrep.2022.110776.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4527
• Total vector size (bp): 5850
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: eGFP-P2A-LgBiT-NLS
• Alt name: GPLN
• Insert Size (bp): 1323
• Promoter: hSyn

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CTGCCTCAGTCTGCGGTG
• 3′ sequencing primer: TGAAAGCCATACGGGAAGCA

Resource Information

• Supplemental Documents:
  • pAAV-hSyn-eGFP-P2A-LgBiT-NLS.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry