Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRK172-6xHis-0N4R-P301S-tau-HiBiT
(Plasmid #187835)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 187835 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRK172
  • Backbone size w/o insert (bp) 2542
  • Total vector size (bp) 3760
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For protein production, 16 degrees in DE3 BL21 E coli
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    6XHis-0N4R-P301S-tau-HiBiT
  • Alt name
    Tau-HiBiT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1218
  • Promoter T7
  • Tags / Fusion Proteins
    • 6xHistidine (N terminal on insert)
    • HiBiT (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GATCTCGATCCCGCGAAATT
  • 3′ sequencing primer CAAGACCCGTTTAGAGGCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRK172-6xHis-0N4R-P301S-tau-HiBiT was a gift from William McEwan (Addgene plasmid # 187835 ; http://n2t.net/addgene:187835 ; RRID:Addgene_187835)
  • For your References section:

    Cholesterol determines the cytosolic entry and seeded aggregation of tau. Tuck BJ, Miller LVC, Katsinelos T, Smith AE, Wilson EL, Keeling S, Cheng S, Vaysburd MJ, Knox C, Tredgett L, Metzakopian E, James LC, McEwan WA. Cell Rep. 2022 May 3;39(5):110776. doi: 10.1016/j.celrep.2022.110776. 10.1016/j.celrep.2022.110776 PubMed 35508140