Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mcherry p62 delta UBA silent
(Plasmid #187984)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 187984 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmCherry-C1 Vector
  • Backbone manufacturer
    Clontech #632524
  • Backbone size w/o insert (bp) 4722
  • Total vector size (bp) 5707
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    p62
  • Species
    H. sapiens (human)
  • Mutation
    Lacking UBA domain (aa389-434) but it has the silent mutations to be resistant to sip62 #5
  • GenBank ID
    23636 NM_153719
  • Entrez Gene
    NUP62 (a.k.a. IBSN, SNDI, p62)
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AAATGGCGTCGCTCACCGTGAAGGCCT
  • 3′ sequencing primer ggTCACAACGGCGGGGGATGCTTTGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mcherry p62 delta UBA silent was a gift from Sascha Martens (Addgene plasmid # 187984 ; http://n2t.net/addgene:187984 ; RRID:Addgene_187984)
  • For your References section:

    Oligomerization of p62 allows for selection of ubiquitinated cargo and isolation membrane during selective autophagy. Wurzer B, Zaffagnini G, Fracchiolla D, Turco E, Abert C, Romanov J, Martens S. Elife. 2015 Sep 28;4:e08941. doi: 10.7554/eLife.08941. 10.7554/eLife.08941 PubMed 26413874