pCHAC-mt-mKeima
(Plasmid #72342)

• Purpose: retrovirus construct for stable expressing mt-mKeima
• Depositing Lab: Richard Youle
• Publication: Lazarou et al Nature. 2015 Aug 20;524(7565):309-14. doi: 10.1038/nature14893. Epub 2015 Aug 12.

Backbone

• Vector backbone: pCHAC-MCS1-IRES-MCS2
• Backbone manufacturer: AlleleBiotechnology
• Backbone size w/o insert (bp): 5632
• Total vector size (bp): 6517
• Vector type: Retroviral
• Selectable markers: none

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mt-mKeima
• Species: stony coral Montipora
• Insert Size (bp): 894
• GenBank ID: AB209969

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: TGACCTGGGAAGCCTTGGCT
• 3′ sequencing primer: TTGCCAAAAGACGGCAATAT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The insert mt-mKeima was cut out from the original construct pIND(SP1)-mt-mKeima obtained from Dr. Atsushi Miyawaki of Brain Science Institute, RIKEN, Japan
• Articles Citing this Plasmid:
  • 31 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please also cite the original paper describing the use of mt-mkeima by Dr. Atsushi Miyawaki's lab at RIKEN, Japan.
Hiroyuki Katayama et al, 2011. A sensitive and quantitative technique for detecting autophagic events based on lysosomal delivery. Chemistry and Bioogy 18(8): 1042-1052