-
PurposeExpresses GFP-LC3-RFP-LC3ΔG in mammalian cells to measure autophagic flux
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84572 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMRX-IP
-
Backbone manufacturerDr.Shoji Yamaoka of Tokyo Medical and Dental University
- Backbone size w/o insert (bp) 6100
- Total vector size (bp) 8300
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemicrotubule-associated protein 1 light chain 3 beta
-
Alt nameMap1lc3b
-
Alt nameLC3
-
Alt nameLC3B
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2200
-
GenBank IDNM_022867.2
-
Entrez GeneMap1lc3b (a.k.a. LC3B, Map1lc3, Mpl3, zbs559)
-
Tags
/ Fusion Proteins
- EGFP (N terminal on insert)
- mRFP1 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (unknown if destroyed)
- 3′ cloning site Bam HI (unknown if destroyed)
- 5′ sequencing primer CGACCACTACCAGCAGAACA
- 3′ sequencing primer AAAAGACGGCAATATGGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byIt has the pMX backbone
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRX-IP-GFP-LC3-RFP-LC3ΔG was a gift from Noboru Mizushima (Addgene plasmid # 84572 ; http://n2t.net/addgene:84572 ; RRID:Addgene_84572) -
For your References section:
An Autophagic Flux Probe that Releases an Internal Control. Kaizuka T, Morishita H, Hama Y, Tsukamoto S, Matsui T, Toyota Y, Kodama A, Ishihara T, Mizushima T, Mizushima N. Mol Cell. 2016 Nov 17;64(4):835-849. doi: 10.1016/j.molcel.2016.09.037. Epub 2016 Nov 3. 10.1016/j.molcel.2016.09.037 PubMed 27818143