This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMXs-puro GFP-p62
(Plasmid #38277)


Item Catalog # Description Quantity Price (USD)
Plasmid 38277 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Dr. Toshio Kitamura of the University of Tokyo
  • Backbone size w/o insert (bp) 6878
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    Sqstm1 (a.k.a. A170, OSF-6, Osi, STAP, STONE14, p62)
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGACCACTACCAGCAGAACA
  • 3′ sequencing primer AAAATTAGTCAGCCATGGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    p62 cDNA was provied by Dr. Masaaki Komatsu (Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan).
  • Terms and Licenses
  • Articles Citing this Plasmid

Depositor Comments

Ichimura et al., JBC 2008 283, 22847

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-puro GFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ; ; RRID:Addgene_38277)
  • For your References section:

    p62 Targeting to the autophagosome formation site requires self-oligomerization but not LC3 binding. Itakura E, Mizushima N. J Cell Biol. 2011 Jan 10;192(1):17-27. 10.1083/jcb.201009067 PubMed 21220506