NLS-CanlonicSF
(Plasmid
#188390)
-
PurposeTo explore lactate dynamics in intact systems
-
Depositing Lab
-
Depositing OrganizationCentro de Estudios Cientificos
Located in Chile -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188390 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 188390-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 188390-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV-myc-nuc
-
Backbone manufacturerThermo Scientific
- Backbone size w/o insert (bp) 4843
- Total vector size (bp) 6739
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-CanlonicSF
-
SpeciesSynthetic
-
Insert Size (bp)1896
- Promoter CMV
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.10.01.322404v1 for bioRxiv preprint.
DNA (Catalog # 188390-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 188390-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NLS-CanlonicSF was a gift from Alejandro San Martín (Addgene plasmid # 188390 ; http://n2t.net/addgene:188390 ; RRID:Addgene_188390) -
For your References section:
Single-Fluorophore Indicator to Explore Cellular and Sub-cellular Lactate Dynamics. Aburto C, Galaz A, Bernier A, Sandoval PY, Holtheuer-Gallardo S, Ruminot I, Soto-Ojeda I, Hertenstein H, Schweizer JA, Schirmeier S, Pastor TP, Mardones GA, Barros LF, San Martin A. ACS Sens. 2022 Oct 28. doi: 10.1021/acssensors.2c00731. 10.1021/acssensors.2c00731 PubMed 36306435
Map uploaded by the depositor.
