Fucci(CA) hCdt1-iRFP hGeminin-iRFP
(Plasmid
#190182)
-
PurposeFluorescent reporter vector for visualization of G0 and other cell cycle phases.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190182 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePB510B-1
-
Backbone manufacturerSystem Biosciences
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameiRFP
-
SpeciesSynthetic
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer Unknown (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namehCdt1(1/100)Cy(-)
-
Alt nameCDT1
-
SpeciesSynthetic
-
Entrez GeneCdt1 (a.k.a. 2610318F11Rik, DUP, Ris2)
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer Unknown (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameiRFP
-
SpeciesSynthetic
- Promoter CMV
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (unknown if destroyed)
- 3′ cloning site NdeI (unknown if destroyed)
- 5′ sequencing primer GAAGAAAACACTCGGCTGGGA
- 3′ sequencing primer tacaaaggcattaaagcagcgta (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namehGeminin(1/110)
-
Alt nameGMNN
-
SpeciesSynthetic
-
GenBank IDNM_001251989.2
- Promoter CMV
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site NdeI (unknown if destroyed)
- 5′ sequencing primer GAAGAAAACACTCGGCTGGGA
- 3′ sequencing primer AAACAACAGATGGCTGGCAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Fucci(CA) hCdt1-iRFP hGeminin-iRFP was a gift from Toshiro Sato (Addgene plasmid # 190182 ; http://n2t.net/addgene:190182 ; RRID:Addgene_190182) -
For your References section:
Cell-matrix interface regulates dormancy in human colon cancer stem cells. Ohta Y, Fujii M, Takahashi S, Takano A, Nanki K, Matano M, Hanyu H, Saito M, Shimokawa M, Nishikori S, Hatano Y, Ishii R, Sawada K, Machinaga A, Ikeda W, Imamura T, Sato T. Nature. 2022 Jul 7. pii: 10.1038/s41586-022-05043-y. doi: 10.1038/s41586-022-05043-y. 10.1038/s41586-022-05043-y PubMed 35798028