pJEC819
(Plasmid #190815)

• Purpose: CRISPRa backbone plasmid harboring BbsI sites for easy cloning of sgRNA targeting regions via Golden gate.
• Depositing Lab: James Chappell
• Publication: Ameruoso et al Nucleic Acids Res. 2022 Jul 22;50(13):7751-7760. doi: 10.1093/nar/gkac556.

Backbone

• Vector backbone: pCRISPomyces-2
• Backbone size w/o insert (bp): 6578
• Total vector size (bp): 11420
• Modifications to backbone: Cas9 changed to dCas9, with promoter SP30 driving its expression, followed by RiboJ and synthetic RBS SR09.
• Vector type: CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Apramycin, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9-XTEN-rpoA
• Species: Synthetic
• Insert Size (bp): 4842
• Promoter: SP30
• Tag / Fusion Protein:
  • XTEN (linker), followed by the N-terminal domain of the RNA Polymerase alpha subunit of Streptomyces venezuelae (RpoA) (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gttcagcaagcgggtcatc
• 3′ sequencing primer: ctccaaaaggagcctttaattg

Resource Information

• Supplemental Documents:
  • pJEC819.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry