pBIG1b_10xHisTEVATG5_ATG12
(Plasmid
#190861)
-
PurposePlasmid for the expression of ATG5 and ATG12 protein subunit complexes. Internal References: SMC1178
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190861 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBIG1b
-
Backbone manufacturerJan-Michael Peters
- Backbone size w/o insert (bp) 5915
- Total vector size (bp) 8315
-
Vector typeBacterial Expression, Insect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameATG5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)894
-
GenBank IDNC_000006.12
-
Entrez GeneATG5 (a.k.a. APG5, APG5-LIKE, APG5L, ASP, SCAR25, hAPG5)
-
Tag
/ Fusion Protein
- 6xHis-TEV (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CCACCATCGGGCGCGGATCCATGGCCGAAGAGCCC
- 3′ sequencing primer TCCTCTAGTACTTCTCGACAAGCTTTTAGTCCGTAGGTTGGGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameATG12
-
SpeciesH. sapiens (human)
-
Insert Size (bp)423
-
GenBank IDNC_000005.10
-
Entrez GeneATG12 (a.k.a. APG12, APG12L, FBR93, HAPG12)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CCACCATCGGGCGCGGATCCATGGCCGAAGAGCCC
- 3′ sequencing primer CCACCATCGGGCGCGGATCCATGGCCGAAGAGCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBIG1b_10xHisTEVATG5_ATG12 was a gift from Sascha Martens (Addgene plasmid # 190861 ; http://n2t.net/addgene:190861 ; RRID:Addgene_190861) -
For your References section:
A PI3K-WIPI2 positive feedback loop allosterically activates LC3 lipidation in autophagy. Fracchiolla D, Chang C, Hurley JH, Martens S. J Cell Biol. 2020 Jul 6;219(7). pii: 151802. doi: 10.1083/jcb.201912098. 10.1083/jcb.201912098 PubMed 32437499