pAf-CRISPR-yA
(Plasmid
#191015)
-
PurposeCRISPR vector based on Aspergillus flavus U6 promoter and terminator for targeting the yA gene, which contains AMA1(the HindIII-PstI fragment) and ptrA selection marker.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191015 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPTRII
-
Backbone manufacturerTaKaRa
- Backbone size w/o insert (bp) 10031
- Total vector size (bp) 13436
-
Modifications to backboneRemoval of the PstI fragment of pPTRII (AMA1), expression of cas9 using Aspergillus nidulans gpdA promoter and trpC terminator, expression of sgRNA using Aspergillus flavus U6 promoter and terminator.
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameyA
-
gRNA/shRNA sequenceTTAGTGAGAATCATTTGGCG
-
SpeciesAspergillus flavus
- Promoter Aspergillus flavus U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer ATACTGCAGTTCTCTTTAGAATTCAACTGTGGGT
- 3′ sequencing primer TATGGTACCACATATTTAAAAAAAGTCTCCTGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAf-CRISPR-yA was a gift from Perng-Kuang Chang (Addgene plasmid # 191015 ; http://n2t.net/addgene:191015 ; RRID:Addgene_191015) -
For your References section:
A Simple CRISPR/Cas9 System for Efficiently Targeting Genes of Aspergillus Section Flavi Species, Aspergillus nidulans, Aspergillus fumigatus, Aspergillus terreus, and Aspergillus niger. Chang PK. Microbiol Spectr. 2023 Feb 14;11(1):e0464822. doi: 10.1128/spectrum.04648-22. Epub 2023 Jan 18. 10.1128/spectrum.04648-22 PubMed 36651760