Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJH4260
(Plasmid #191678)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 191678 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBSK
  • Backbone manufacturer
    stratagene
  • Backbone size w/o insert (bp) 5890
  • Total vector size (bp) 7414
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6s
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    1524
  • Promoter Ptwk-40
  • Tag / Fusion Protein
    • wScarlet (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer CCAAAAAATGGGATCTCACCACCA
  • 3′ sequencing primer CGCCAGATCCTCCACGTCCTCCCTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJH4260 was a gift from Mei Zhen (Addgene plasmid # 191678 ; http://n2t.net/addgene:191678 ; RRID:Addgene_191678)
  • For your References section:

    Extrasynaptic signaling enables an asymmetric juvenile motor circuit to produce symmetric undulation. Lu Y, Ahamed T, Mulcahy B, Meng J, Witvliet D, Guan SA, Holmyard D, Hung W, Wen Q, Chisholm AD, Samuel ADT, Zhen M. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. Epub 2022 Sep 30. 10.1016/j.cub.2022.09.002 PubMed 36182701