pJH4260
(Plasmid
#191678)
-
PurposePtwk-40s-GCaMP::wScarlet unc-54 3' UTR C.elegans AVA/other neurons expression GCaMP6s wScarlet
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191678 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBSK
-
Backbone manufacturerstratagene
- Backbone size w/o insert (bp) 5890
- Total vector size (bp) 7414
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP6s
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1524
- Promoter Ptwk-40
-
Tag
/ Fusion Protein
- wScarlet (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer CCAAAAAATGGGATCTCACCACCA
- 3′ sequencing primer CGCCAGATCCTCCACGTCCTCCCTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJH4260 was a gift from Mei Zhen (Addgene plasmid # 191678 ; http://n2t.net/addgene:191678 ; RRID:Addgene_191678) -
For your References section:
Extrasynaptic signaling enables an asymmetric juvenile motor circuit to produce symmetric undulation. Lu Y, Ahamed T, Mulcahy B, Meng J, Witvliet D, Guan SA, Holmyard D, Hung W, Wen Q, Chisholm AD, Samuel ADT, Zhen M. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. Epub 2022 Sep 30. 10.1016/j.cub.2022.09.002 PubMed 36182701