Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET28 acid.6
(Plasmid #191912)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 191912 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET28
  • Backbone size w/o insert (bp) 5209
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    acid.6
  • Species
    Aequorea victoria
  • Insert Size (bp)
    747
  • Mutation
    Q69L S72A Y145M T167V H181L
  • Promoter T7
  • Tag / Fusion Protein
    • His Tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer gctagttattgctcagcgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Design created by the htFuncLib algorithm

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28 acid.6 was a gift from Sarel Fleishman (Addgene plasmid # 191912 ; http://n2t.net/addgene:191912 ; RRID:Addgene_191912)
  • For your References section:

    Designed active-site library reveals thousands of functional GFP variants. Weinstein JY, Marti-Gomez C, Lipsh-Sokolik R, Hoch SY, Liebermann D, Nevo R, Weissman H, Petrovich-Kopitman E, Margulies D, Ivankov D, McCandlish DM, Fleishman SJ. Nat Commun. 2023 May 20;14(1):2890. doi: 10.1038/s41467-023-38099-z. 10.1038/s41467-023-38099-z PubMed 37210560