Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP
(Plasmid #194016)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 194016 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Hetian Lei #85451
  • Backbone size w/o insert (bp) 5163
  • Total vector size (bp) 5183
  • Modifications to backbone
    addition of gRNA
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    sgRNA(Oxtr.2)
  • Alt name
    sgRNA(Oxtr)
  • gRNA/shRNA sequence
    GTGATGTCCCACAGCAGCTG
  • Species
    M. musculus (mouse), R. norvegicus (rat); prairie vole, california deer mouse, golden hamster, spiny mouse
  • Insert Size (bp)
    20
  • Promoter u6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SapI (destroyed during cloning)
  • 3′ cloning site Sap! (destroyed during cloning)
  • 5′ sequencing primer cgcgtgagggcctatttcc
  • 3′ sequencing primer Unknown
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    eGFP
  • Alt name
    enhanced green fluorescent protein
  • gRNA/shRNA sequence
    N/A
  • Species
    Aequorea victoria
  • Promoter cmb

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer Unknown
  • 3′ sequencing primer Unknown
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP was a gift from Larry Young (Addgene plasmid # 194016 ; http://n2t.net/addgene:194016 ; RRID:Addgene_194016)
  • For your References section:

    An AAV-CRISPR/Cas9 strategy for gene editing across divergent rodent species: Targeting neural oxytocin receptors as a proof of concept. Boender AJ, Boon M, Albers HE, Eck SR, Fricker BA, Kelly AM, LeDoux JE, Motta SC, Shrestha P, Taylor JH, Trainor BC, Triana-Del Rio R, Young LJ. Sci Adv. 2023 Jun 2;9(22):eadf4950. doi: 10.1126/sciadv.adf4950. Epub 2023 May 31. 10.1126/sciadv.adf4950 PubMed 37256960