Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

6xHis-MBP-BrCas12b-RFND
(Plasmid #195339)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 195339 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET
  • Backbone manufacturer
    Scott Gradia Lab (Addgene plasmid # 29656)
  • Backbone size w/o insert (bp) 6401
  • Total vector size (bp) 9670
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BrCas12b
  • Species
    Brevibacillus sp. SYP-B805
  • Insert Size (bp)
    3269
  • Mutation
    R160E, F208W, N524V, D868V
  • GenBank ID
    WP_165214399.1
  • Promoter T7
  • Tags / Fusion Proteins
    • 6xHis, MBP, TEV cleavage site (N terminal on backbone)
    • 6xHis (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Twist Bioscience (wild-type gene). Variants were modified by the UF lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    6xHis-MBP-BrCas12b-RFND was a gift from Piyush Jain (Addgene plasmid # 195339 ; http://n2t.net/addgene:195339 ; RRID:Addgene_195339)
  • For your References section:

    Engineering highly thermostable Cas12b via de novo structural analyses for one-pot detection of nucleic acids. Nguyen LT, Rananaware SR, Yang LG, Macaluso NC, Ocana-Ortiz JE, Meister KS, Pizzano BLM, Sandoval LSW, Hautamaki RC, Fang ZR, Joseph SM, Shoemaker GM, Carman DR, Chang L, Rakestraw NR, Zachary JF, Guerra S, Perez A, Jain PK. Cell Rep Med. 2023 May 16;4(5):101037. doi: 10.1016/j.xcrm.2023.101037. Epub 2023 May 8. 10.1016/j.xcrm.2023.101037 PubMed 37160120