6xHis-MBP-BrCas12b-FNLDTA
(Plasmid #195340)

• Purpose: Expresses Engineered BrCas12b in Bacteria
• Depositing Lab: Piyush Jain
• Publication: Nguyen et al Cell Rep Med. 2023 May 16;4(5):101037. doi: 10.1016/j.xcrm.2023.101037. Epub 2023 May 8.

Backbone

• Vector backbone: pET
• Backbone manufacturer: Scott Gradia Lab (Addgene plasmid # 29656)
• Backbone size w/o insert (bp): 6401
• Total vector size (bp): 9670
• Vector type: Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BrCas12b
• Species: Brevibacillus sp. SYP-B805
• Insert Size (bp): 3269
• Mutation: F208W, N524V, L795I, D868V, T874S, A1015E
• GenBank ID: WP_165214399.1
• Promoter: T7 Promoter
• Tags / Fusion Proteins:
  • MBP, TEV cleavage site, 6x His Tag (N terminal on backbone)
  • 6xHis Tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Twist Bioscience (wild-type gene). Variants were modified by the UF lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry