pRSET.HaloTag.v7.AviTag
(Plasmid
#195486)
-
PurposeBacterial expression plasmid with Halotag v7 insert plus a C-terminus appended AviTag for enzymatic biotinylation.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195486 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRSET
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2863
- Total vector size (bp) 3814
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHaloTag.v7.AviTag
-
Insert Size (bp)951
- Promoter T7
-
Tags
/ Fusion Proteins
- AviTag (C terminal on insert)
- 6xHIS (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSET.HaloTag.v7.AviTag was a gift from Tim Brown & HHMI-JRC Tool Translation Team (Addgene plasmid # 195486 ; http://n2t.net/addgene:195486 ; RRID:Addgene_195486)