Pb-TRE3G-TYR-HygR
(Plasmid #195508)

• Purpose: inducible Piggybac vector expressing human TYR CDS with hygromycin selection
• Depositing Lab: Joanna Wysocka
• Publication: Bajpai et al Science. 2023 Aug 11;381(6658):eade6289. doi: 10.1126/science.ade6289. Epub 2023 Aug 11.

Backbone

• Vector backbone: piggyBac
• Backbone size w/o insert (bp): 8017
• Total vector size (bp): 9705
• Vector type: Mammalian Expression ; piggyBac
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TYR
• Species: H. sapiens (human)
• Insert Size (bp): 1688
• Entrez Gene: TYR (a.k.a. ATN, CMM8, OCA1, OCA1A, OCAIA, SHEP3)
• Promoter: TRE

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: cacccgtgcgttttattctg
• 3′ sequencing primer: atcgcctggagcaattccac

Resource Information

• Supplemental Documents:
  • 171_PB_TRE3G_TYR_HygR_sequenced_H1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry