Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TRUPATH Triple Gai3
(Plasmid #196050)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 196050 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone manufacturer
    Genscript
  • Backbone size w/o insert (bp) 5118
  • Total vector size (bp) 9843
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    GAlphai3-RLuc8
  • Alt name
    GNAI3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2031
  • Mutation
    RLuc8 and flanking SGGGGS linkers have been inserted at amino acid position 99 of the alpha subunit
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer gccacgttgtgagttggatag
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    GGamma9-GFP2
  • Alt name
    GNG9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    939
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP2 and GSAG linker (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer gagggcagaggaagtcttc
  • 3′ sequencing primer GATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    GBeta3
  • Alt name
    GNB3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1020
  • Promoter CMV

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ccggtagggccgggattc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TRUPATH Triple Gai3 was a gift from Justin English (Addgene plasmid # 196050 ; http://n2t.net/addgene:196050 ; RRID:Addgene_196050)
  • For your References section:

    TRUPATH, an open-source biosensor platform for interrogating the GPCR transducerome. Olsen RHJ, DiBerto JF, English JG, Glaudin AM, Krumm BE, Slocum ST, Che T, Gavin AC, McCorvy JD, Roth BL, Strachan RT. Nat Chem Biol. 2020 May 4. pii: 10.1038/s41589-020-0535-8. doi: 10.1038/s41589-020-0535-8. 10.1038/s41589-020-0535-8 PubMed 32367019