pEGFP-U6
(Plasmid #19799)

Loading...
Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    empty vector

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATATCCCTTGGAGAAAAGCCTT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid is modified from pEGFP-N1. Please see author's sequence for U6 modification. The modified MCS part with deletion of the fragment between Hind III and Xma I:

GCTAGCGCTACCGACTCAGATCTCGAGCTCAGATCCACCGGTCGCCACCATGGTG

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-U6 was a gift from Zuoshang Xu (Addgene plasmid # 19799)
  • For your References section:

    A construct with fluorescent indicators for conditional expression of miRNA. Qiu L, Wang H, Xia X, Zhou H, Xu Z. BMC Biotechnol. 2008 . 8():77. 10.1186/1472-6750-8-77 PubMed 18840295