1
Plasmid 19799: pEGFP-U6
Comments: 

This plasmid is modified from pEGFP-N1. Please see author's sequence for U6 modification. The modified MCS part with deletion of the fragment between Hind III and Xma I:

GCTAGCGCTACCGACTCAGATCTCGAGCTCAGATCCACCGGTCGCCACCATGGTG

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: A construct with fluorescent indicators for conditional expression of miRNA. Qiu et al (BMC Biotechnol. 2008 . 8():77. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 19799" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only