1
Plasmid 19799: pEGFP-U6
  • empty vector

  • pEGFP-N1
    (Search Vector Database)

  • Mammalian Expression, RNAi

  • 5000

  • PmeI

  • No

  • EcoRI

  • No

  • ATATCCCTTGGAGAAAAGCCTT List of Sequencing Primers

  • Kanamycin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (4)
  • Zuoshang Xu

  • MTA

Comments: 

This plasmid is modified from pEGFP-N1. Please see author's sequence for U6 modification. The modified MCS part with deletion of the fragment between Hind III and Xma I:

GCTAGCGCTACCGACTCAGATCTCGAGCTCAGATCCACCGGTCGCCACCATGGTG

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A construct with fluorescent indicators for conditional expression of miRNA. Qiu et al (BMC Biotechnol. 2008 . 8():77. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 19799" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only