|
Plasmid
19799:
pEGFP-U6
|
Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result. A construct with fluorescent indicators for conditional expression of miRNA. Qiu et al (BMC Biotechnol. 2008 . 8():77. PubMed) Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 19799" in your Materials and Methods section. |
This plasmid is modified from pEGFP-N1. Please see author's sequence for U6 modification. The modified MCS part with deletion of the fragment between Hind III and Xma I:
GCTAGCGCTACCGACTCAGATCTCGAGCTCAGATCCACCGGTCGCCACCATGGTG