EF1α-Lox2272-LoxP-MARKS·mTurquoise2-NLS·turboRFP-Lox2272-LoxP
(Plasmid
#198753)
-
PurposeCre reporter, which switches from membraneous mTurquoise to nuclear RFP upon Cre recombinase activity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198753 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbone#37120 pAAV-EF1a-DO_DIO-TdTomato_EGFP-WPRE-pA
-
Backbone manufacturerK. Deisseroth Lab
- Backbone size w/o insert (bp) 5627
- Total vector size (bp) 11151
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
-
Selectable markersZeocin ; Bleomycin, Phleomycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEF1a promotor-Lox2272-LoxP-MARKS-mTurquoise2-NLS.turboRFP-Lox2272-LOXP
-
Alt namemembraneTq2 - NLS.turboRFP
-
SpeciesSynthetic
-
Insert Size (bp)2893
-
MutationSee depositor comments below
-
GenBank ID
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTTCCATTTCAGGTGTCGTG
- 3′ sequencing primer cgaggtcgacggtatcg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bybackbone:pAAV-Ef1a-DO_DIO-TdTomato_EGFP-WPRE-pA (Bernardo Sabatini), inserts: Rosa26 mT/mG (Liqun Luo), pK263.CAG-loxP-stop-loxP-NLSturboRFP-ires-tTA-WPRE (Takuji Iwasato). For more information, see comments
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Using pAAV-Ef1a-DO_DIO-TdTomato_EGFP-WPRE-pA (Bernardo Sabatini, #37120) as a backbone (cut AscI/NheI), we ligated the following fragments: first, we PCR the membrane bound sequence (MARKS, Rosa26 mT/mG (Liqun Luo), #17787), the mTurquoise2 sequence (+stop codon), and the nuclear NLS·turboRFP sequence (+stop codon) from pK263.CAG-loxP-stop-loxP-NLSturboRFP-ires-tTA-WPRE (Takuji Iwasato, #89587). MARKS was fused by PCR to mTurquoise2 using forward overlapping regions and NLS·turboRFP was fused to mTurquoise2 in a reversed orientation. The fusion product was ligated to the lentiviral backbone using the AscI-NheI restriction enzyme sites.
Please note: The plasmid contains AQ3-4CC mutations in MARCKS compared to the NCBI reference sequence AAH28284.1. These mutations are not expected to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EF1α-Lox2272-LoxP-MARKS·mTurquoise2-NLS·turboRFP-Lox2272-LoxP was a gift from Jacco van Rheenen (Addgene plasmid # 198753 ; http://n2t.net/addgene:198753 ; RRID:Addgene_198753) -
For your References section:
A doxycycline- and light-inducible Cre recombinase mouse model for optogenetic genome editing. Vizoso M, E J Pritchard C, Bombardelli L, van den Broek B, Krimpenfort P, Beijersbergen RL, Jalink K, van Rheenen J. Nat Commun. 2022 Oct 28;13(1):6442. doi: 10.1038/s41467-022-33863-z. 10.1038/s41467-022-33863-z PubMed 36307419