pEGFP-C3-Rabaptin-5
(Plasmid #199173)

• Purpose: Expresses GFP-Rabaptin-5 fusion in mammalian cells
• Depositing Lab: Juan Bonifacino
• Publication: Mattera et al EMBO J. 2003 Jan 2;22(1):78-88. doi: 10.1093/emboj/cdg015.

Backbone

• Vector backbone: pEGFP-C3
• Backbone size w/o insert (bp): 4727
• Total vector size (bp): 7452
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Rabaptin-5
• Species: H. sapiens (human)
• Insert Size (bp): 2726
• Mutation: Contains Tyr 149 Ser substitution; insert starts at codon 6 (encodes human Rabaptin-5 (6-862))
• Entrez Gene: RABEP1 (a.k.a. RAB5EP, RABPT5)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (destroyed during cloning)
• 3′ cloning site: SmaI (destroyed during cloning)
• 5′ sequencing primer: pEGFP-C forward: 5’ CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: pEGFP-C reverse: 5’ GCTTTATTTGTGAAATTTGTGATGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

ApaI/NotI Rabaptin-5 insert was polished with T7 DNA polymerase and subcloned into SmaI site of pEGFP-C3 vector. Insert contains ~140 bp of 3' UTR after stop codon.