LPUtopia-7
(Plasmid #199212)

• Purpose: Landing Pad Utopia_v7 donor plasmid for AAVS1 site-specific integration in human cells. Use NeoR and eGFP as positive selection marker for AAVS1-targeted insertion and RFP as negative selection marker
• Depositing Lab: Gabor Balazsi
• Publication: Wan et al Nat Chem Biol. 2023 Jul;19(7):887-899. doi: 10.1038/s41589-023-01344-z. Epub 2023 May 25.

Backbone

• Vector backbone: DC-RFP-SH01
• Backbone manufacturer: GeneCopoeia
• Backbone size w/o insert (bp): 5630
• Total vector size (bp): 9429
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: aminoglycoside phosphotransferase,
• Alt name: NeoR/KanR
• Species: Synthetic
• Insert Size (bp): 804
• Promoter: thymidine kinase promoter

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsrGI (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: TCCACCCCACAGTGGGGC
• 3′ sequencing primer: gagcagattgtactgagagtcgacgg

Gene/Insert 2

• Gene/Insert name: enhanced Green Fluorescence Protein
• Alt name: GFP
• Species: Synthetic
• Insert Size (bp): 719
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsrGI (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: GACATTGATTATTGACTAGTTATTAA
• 3′ sequencing primer: ctctcgttaattaactcgag

Gene/Insert 3

• Gene/Insert name: Red Fluorescence Protein
• Alt name: RFP
• Species: Synthetic
• Insert Size (bp): 699
• Promoter: CMV

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gggggactttcctacttggc
• 3′ sequencing primer: cagcaacgcggcctttttac

Resource Information

• Supplemental Documents:
  • LPUtopia-7

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry