pCAG-eSpCas9_sgAAVS1
(Plasmid
#199213)
-
PurposeAll-in-one plasmid encoding eSpCas9 and sgRNA targeting the AAVS1 site in human cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199213 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneeSpCas9(1.1)
-
Backbone manufacturerFeng Zhang lab
- Backbone size w/o insert (bp) 8482
- Total vector size (bp) 8506
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAVS1-gRNA
-
SpeciesSynthetic
- Promoter human U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer ttttgctggccttttgctca
- 3′ sequencing primer tctgcagacaaatggctcta (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-eSpCas9_sgAAVS1 was a gift from Gabor Balazsi (Addgene plasmid # 199213 ; http://n2t.net/addgene:199213 ; RRID:Addgene_199213) -
For your References section:
Nonmonotone invasion landscape by noise-aware control of metastasis activator levels. Wan Y, Cohen J, Szenk M, Farquhar KS, Coraci D, Krzyszton R, Azukas J, Van Nest N, Smashnov A, Chern YJ, De Martino D, Nguyen LC, Bien H, Bravo-Cordero JJ, Chan CH, Rosner MR, Balazsi G. Nat Chem Biol. 2023 Jul;19(7):887-899. doi: 10.1038/s41589-023-01344-z. Epub 2023 May 25. 10.1038/s41589-023-01344-z PubMed 37231268