pUt-mPF-GFP
(Plasmid
#199222)
-
PurposeLPUtopia-7 matching RMCE donor plasmid with GFP Positive-Feedback circuit (mPF-GFP). Use BlastR for positive selection and HSV-TK for negative selection.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199222 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUt-mNF-GFP
-
Backbone manufacturerBalazsi Lab
- Backbone size w/o insert (bp) 7902
- Total vector size (bp) 9925
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Blasticidin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namertTA-Advanced::P2A::EGFP
-
Alt namereverse tetracycline Transactivator
-
Alt nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)1877
-
GenBank ID
- Promoter tight TRE promoter
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATATACGCGTCGAGGCCCTTTC
- 3′ sequencing primer GATCCTTACTTGTACAGCTCGTCCATGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUt-mPF-GFP was a gift from Gabor Balazsi (Addgene plasmid # 199222 ; http://n2t.net/addgene:199222 ; RRID:Addgene_199222) -
For your References section:
Nonmonotone invasion landscape by noise-aware control of metastasis activator levels. Wan Y, Cohen J, Szenk M, Farquhar KS, Coraci D, Krzyszton R, Azukas J, Van Nest N, Smashnov A, Chern YJ, De Martino D, Nguyen LC, Bien H, Bravo-Cordero JJ, Chan CH, Rosner MR, Balazsi G. Nat Chem Biol. 2023 Jul;19(7):887-899. doi: 10.1038/s41589-023-01344-z. Epub 2023 May 25. 10.1038/s41589-023-01344-z PubMed 37231268