pCA28-pMa-PspCas13b crRNA-TS1
(Plasmid
#199459)
-
PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199459 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTS1 crRNA
-
gRNA/shRNA sequenceCCTCCTCGGAGAGCATCGGTGC
-
SpeciesH. sapiens (human)
- Promoter mouse U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCA28-pMa-PspCas13b crRNA-TS1 was a gift from Baohui Chen (Addgene plasmid # 199459 ; http://n2t.net/addgene:199459 ; RRID:Addgene_199459) -
For your References section:
Gene activation guided by nascent RNA-bound transcription factors. Liang Y, Xu H, Cheng T, Fu Y, Huang H, Qian W, Wang J, Zhou Y, Qian P, Yin Y, Xu P, Zou W, Chen B. Nat Commun. 2022 Nov 28;13(1):7329. doi: 10.1038/s41467-022-35041-7. 10.1038/s41467-022-35041-7 PubMed 36443367