Gene activation guided by nascent RNA-bound transcription factors.
Liang Y, Xu H, Cheng T, Fu Y, Huang H, Qian W, Wang J, Zhou Y, Qian P, Yin Y, Xu P, Zou W, Chen B
Nat Commun. 2022 Nov 28;13(1):7329. doi: 10.1038/s41467-022-35041-7. PubMed Article
Liang Y, Xu H, Cheng T, Fu Y, Huang H, Qian W, Wang J, Zhou Y, Qian P, Yin Y, Xu P, Zou W, Chen B
Nat Commun. 2022 Nov 28;13(1):7329. doi: 10.1038/s41467-022-35041-7. PubMed Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 199450 | pCA19-HSPB1 5'HA-TriTag (mTagBFP)-3'HA (HDR donor) | CRISPR donor plasmid to insert TriTag (mTagBFP harbors 12XMS2 in its intron) into the C-terminus of human HSPB1 gene |
| 199451 | pCA20-HSPB1 5'HA-mTagBFP-3'-UTR 12XMS2V5-3'HA (HDR donor) | CRISPR donor plasmid to insert [mTagBFP-stop-12XMS2] into the C-terminus of human HSPB1 gene; 12XMS2 locates in the 3' UTR region |
| 199452 | pCA21-HSPB1 5'HA-NarTag (12XPP7)-3'HA (HDR donor) | CRISPR donor plasmid to insert NarTag (mTagBFP harbors 12XPP7 in its intron) into the C-terminus of human HSPB1 gene |
| 199453 | pCA22-SEC61B 5'HA-TriTag (mTagBFP)-3'HA (HDR donor) | CRISPR donor plasmid to insert TriTag (mTagBFP) into the C-terminus of human SEC61B gene |
| 199454 | pCA23-sgRNA vector-U6-sgTS2 (SpCas9) | U6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC) |
| 199455 | pCA24-pHR-CMV-stdMCP-p65-HSF1-T2A-GFP | Expression of stdMCP-PH in mammalian cells |
| 199456 | pCA25-pHR-CMV-stdPCP-p65-HSF1-T2A-GFP | Expression of stdPCP-PH in mammalian cells |
| 199457 | pCA26-pLenti.CAG.-NLS-dCas13b-NLS-VPR-T2A-HaloTag | Expression of dCas13-VPR in mammalian cells |
| 199458 | pCA27-pHR-MiniCMV-TriTag (mTagBFP) | Expression of TriTag (mTagBFP) in mammalian cells |
| 199459 | pCA28-pMa-PspCas13b crRNA-TS1 | U6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC ) |
| 199460 | pCA29-pCS2-CMV-Zebrafish NarTag (eGFP) | Expression of Zebrafish NarTag (eGFP harbors 9XMS2 in its intron) in zebrafish embryos |
| 199461 | pCA30-pCS2-CMV-stdMCP-p65-HSF1 | Expression of stdMCP-PH in zebrafish embryos |
| 199462 | pCA31-pCS2-CMV-stdPCP-p65-HSF1 | Expression of stdPCP-PH in zebrafish embryos |