Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PB513B-1/TRE-hHNF1β-hHNF4α-hHNF6-EF1α-Bla
(Plasmid #199551)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 199551 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PB513B-1
  • Backbone manufacturer
    SBI
  • Vector type
    Mammalian Expression ; PiggyBac transposon vector
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hHNF1β-hHNF4α-hHNF6
  • Species
    H. sapiens (human)
  • Entrez Gene
    ONECUT1 (a.k.a. HNF-6, HNF6, HNF6A)
  • Entrez Gene
    HNF4A (a.k.a. FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF-14, TCF14)
  • Entrez Gene
    HNF1B (a.k.a. ADTKD3, FJHN, HNF-1-beta, HNF-1B, HNF1beta, HNF2, HPC11, LF-B3, LFB3, MODY5, RCAD, T2D, TCF-2, TCF2, VHNF1)
  • Promoter TRE+CMVmin promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CCCAGTCACGACGTTGTAAAACG
  • 3′ sequencing primer AGCGGATAACAATTTCACACAGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB513B-1/TRE-hHNF1β-hHNF4α-hHNF6-EF1α-Bla was a gift from Masamichi Kamihira (Addgene plasmid # 199551 ; http://n2t.net/addgene:199551 ; RRID:Addgene_199551)
  • For your References section:

    HepG2-Based Designer Cells with Heat-Inducible Enhanced Liver Functions. Kitano H, Kawabe Y, Kamihira M. Cells. 2022 Apr 1;11(7):1194. doi: 10.3390/cells11071194. 10.3390/cells11071194 PubMed 35406758