pAAV_tKiMBI-T2A-caMEK
(Plasmid
#199578)
-
PurposeExpress tKiMBI and caMEK in an AAV vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199578 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 7242
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameERK tdTomato-Kinase-Modulated Bioluminescent Indicator
-
Alt nameERK tKiMBI
-
SpeciesSynthetic
-
Insert Size (bp)2112
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer TCTGGCTAACTAGAGAACCCA
- 3′ sequencing primer GGAAGAAAACCCAGGGCCT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameconstitutively active MEK
-
Alt namecaMEK
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1176
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CCGGTGAAGGTCGAGGCTC
- 3′ sequencing primer AGCCATCTGTTGTTTGCCCCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_tKiMBI-T2A-caMEK was a gift from Michael Lin (Addgene plasmid # 199578 ; http://n2t.net/addgene:199578 ; RRID:Addgene_199578) -
For your References section:
Kinase-Modulated Bioluminescent Indicators Enable Noninvasive Imaging of Drug Activity in the Brain. Wu Y, Walker JR, Westberg M, Ning L, Monje M, Kirkland TA, Lin MZ, Su Y. ACS Cent Sci. 2023 Mar 20;9(4):719-732. doi: 10.1021/acscentsci.3c00074. eCollection 2023 Apr 26. 10.1021/acscentsci.3c00074 PubMed 37122464