Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV_tKiMBImut-T2A-caMEK
(Plasmid #199579)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 199579 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 7242
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    ERK tdTomato-Kinase-Modulated Bioluminescent Indicator (mutant)
  • Alt name
    ERK tKiMBImut
  • Species
    Synthetic
  • Insert Size (bp)
    2112
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCTGGCTAACTAGAGAACCCA
  • 3′ sequencing primer GGAAGAAAACCCAGGGCCT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    constitutively active MEK
  • Alt name
    caMEK
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1176
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCCGGATCCGGTGAAGGTC
  • 3′ sequencing primer AGCCATCTGTTGTTTGCCCCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_tKiMBImut-T2A-caMEK was a gift from Michael Lin (Addgene plasmid # 199579 ; http://n2t.net/addgene:199579 ; RRID:Addgene_199579)
  • For your References section:

    Kinase-Modulated Bioluminescent Indicators Enable Noninvasive Imaging of Drug Activity in the Brain. Wu Y, Walker JR, Westberg M, Ning L, Monje M, Kirkland TA, Lin MZ, Su Y. ACS Cent Sci. 2023 Mar 20;9(4):719-732. doi: 10.1021/acscentsci.3c00074. eCollection 2023 Apr 26. 10.1021/acscentsci.3c00074 PubMed 37122464