Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLL3.7m_tKiMBImut-T2A-AkaLuc-P2A-Blasticidin
(Plasmid #199585)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 199585 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLL3.7m
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 10585
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    ERK tdTomato-Kinase-Modulated Bioluminescent Indicator(mutant)
  • Alt name
    ERK tKiMBImut
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2112
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggtttagtgaaccgtcagatccgc
  • 3′ sequencing primer GGAAGAAAACCCAGGGCCT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    AkaLuc
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1650
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCAGTGGATAAAGCAAAGCTGTC
  • 3′ sequencing primer ttcttgagacaaaggcttgg
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Blasticidin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    395
  • Promoter CMV

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gacggcaagatcgccgtg
  • 3′ sequencing primer tcaagcttatcgataatcaacctctgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL3.7m_tKiMBImut-T2A-AkaLuc-P2A-Blasticidin was a gift from Michael Lin (Addgene plasmid # 199585 ; http://n2t.net/addgene:199585 ; RRID:Addgene_199585)
  • For your References section:

    Kinase-Modulated Bioluminescent Indicators Enable Noninvasive Imaging of Drug Activity in the Brain. Wu Y, Walker JR, Westberg M, Ning L, Monje M, Kirkland TA, Lin MZ, Su Y. ACS Cent Sci. 2023 Mar 20;9(4):719-732. doi: 10.1021/acscentsci.3c00074. eCollection 2023 Apr 26. 10.1021/acscentsci.3c00074 PubMed 37122464