sgLacZ-puro
(Plasmid
#199635)
-
PurposesgRNA control guide targeting bacterial LacZ
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199635 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepXPR_003
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameN/A
-
gRNA/shRNA sequenceCTAACGCCTGGGTCGAACGC
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgLacZ-puro was a gift from William Hahn (Addgene plasmid # 199635 ; http://n2t.net/addgene:199635 ; RRID:Addgene_199635) -
For your References section:
VRK1 as a synthetic lethal target in VRK2 promoter-methylated cancers of the nervous system. So J, Mabe NW, Englinger B, Chow KH, Moyer SM, Yerrum S, Trissal MC, Marques JG, Kwon JJ, Shim B, Pal S, Panditharatna E, Quinn T, Schaefer DA, Jeong D, Mayhew DL, Hwang J, Beroukhim R, Ligon KL, Stegmaier K, Filbin MG, Hahn WC. JCI Insight. 2022 Oct 10;7(19):e158755. doi: 10.1172/jci.insight.158755. 10.1172/jci.insight.158755 PubMed 36040810
