pCDNA4.TO_ORF66_TurboID_3xHA
(Plasmid
#200020)
-
PurposeExpresses KSHV protein ORF66 fused at the C-terminal to TurboID-3xHA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200020 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDNA4.TO
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 5003
- Total vector size (bp) 7403
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameORF66
-
SpeciesKaposi's Sarcoma Associated Herpesvirus (HHV-8)
-
Insert Size (bp)2400
- Promoter CMV
-
Tag
/ Fusion Protein
- TurboID-3xHA (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TACCGAGCTCGGATCATGGCCCTGGATCAGCGC
- 3′ sequencing primer AAACAACAGATGGCTGGCAACTAGAAGGCAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.01.29.526158 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA4.TO_ORF66_TurboID_3xHA was a gift from Britt Glaunsinger (Addgene plasmid # 200020 ; http://n2t.net/addgene:200020 ; RRID:Addgene_200020) -
For your References section:
The viral packaging motor potentiates Kaposi's sarcoma-associated herpesvirus gene expression late in infection. McCollum CO, Didychuk AL, Liu D, Murray-Nerger LA, Cristea IM, Glaunsinger BA. PLoS Pathog. 2023 Apr 17;19(4):e1011163. doi: 10.1371/journal.ppat.1011163. eCollection 2023 Apr. 10.1371/journal.ppat.1011163 PubMed 37068108