pDM002-sgRNA-lenti-ZeoR
(Plasmid
#200060)
-
PurposeLentiviral vector for expression of sgRNA with mCherry, zeocin resistance, BlpI + BstXI cloning sites
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200060 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMCB320, bleomycin resistance marker is in place of puromycin resistance
- Backbone size w/o insert (bp) 8668
- Total vector size (bp) 8668
-
Modifications to backbonebleomycin resistance marker is in place of puromycin resistance
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBleomycin resistance, mCherry
-
gRNA/shRNA sequenceGACCAGGATGGGCACCACCC
- Promoter mU6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pDM002 is modified from pMCB320 (Addgene #89359) from the Bassik lab, where puromycin resistance has been swapped out for zeocin resistance.
Please visit https://doi.org/10.1101/2023.01.29.526158 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDM002-sgRNA-lenti-ZeoR was a gift from Britt Glaunsinger (Addgene plasmid # 200060 ; http://n2t.net/addgene:200060 ; RRID:Addgene_200060) -
For your References section:
The viral packaging motor potentiates Kaposi's sarcoma-associated herpesvirus gene expression late in infection. McCollum CO, Didychuk AL, Liu D, Murray-Nerger LA, Cristea IM, Glaunsinger BA. PLoS Pathog. 2023 Apr 17;19(4):e1011163. doi: 10.1371/journal.ppat.1011163. eCollection 2023 Apr. 10.1371/journal.ppat.1011163 PubMed 37068108