pDM002-sgRNA-lenti-ZeoR
(Plasmid #200060)

• Purpose: Lentiviral vector for expression of sgRNA with mCherry, zeocin resistance, BlpI + BstXI cloning sites
• Depositing Lab: Britt Glaunsinger
• Publication: McCollum et al PLoS Pathog. 2023 Apr 17;19(4):e1011163. doi: 10.1371/journal.ppat.1011163. eCollection 2023 Apr.

Backbone

• Vector backbone: pMCB320, bleomycin resistance marker is in place of puromycin resistance
• Backbone size w/o insert (bp): 8668
• Total vector size (bp): 8668
• Modifications to backbone: bleomycin resistance marker is in place of puromycin resistance
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Bleomycin resistance, mCherry
• gRNA/shRNA sequence: GACCAGGATGGGCACCACCC
• Promoter: mU6

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pDM002 is modified from pMCB320 (Addgene #89359) from the Bassik lab, where puromycin resistance has been swapped out for zeocin resistance.

Please visit https://doi.org/10.1101/2023.01.29.526158 for bioRxiv preprint.