Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pVSL10
(Plasmid #201182)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 201182 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET-28
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5298
  • Total vector size (bp) 7101
  • Modifications to backbone
    Promoter is T5-lacO from pQE-30 (not T7), rnpB terminator, lacIq
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 30 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Avoid saturating overnight cultures. Perform overnights at 30 degC with 1% glucose.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Bst polymerase large fragment (BF) F710Y/D598A
  • Alt name
    DNA polymerase I large fragment from Geobacillus stearothermophilus
  • Species
    Geobacillus stearothermophilus (formerly Bacillus stearothermophilus)
  • Insert Size (bp)
    1803
  • Mutation
    F710Y D598A
  • Promoter T5-lacO
  • Tags / Fusion Proteins
    • His6 (N terminal on insert)
    • HRV 3C protease cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGGATAACAATTTCACACAG
  • 3′ sequencing primer GAGCACCGCCGCCGCAAGGAA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVSL10 was a gift from Jack Szostak (Addgene plasmid # 201182 ; http://n2t.net/addgene:201182 ; RRID:Addgene_201182)
  • For your References section:

    Trivalent rare earth metal cofactors confer rapid NP-DNA polymerase activity. Lelyveld VS, Fang Z, Szostak JW. Science. 2023 Oct 27;382(6669):423-429. doi: 10.1126/science.adh5339. Epub 2023 Oct 26. 10.1126/science.adh5339 PubMed 37883544