pJRH-1328 LV EF1a-CD20 IRES-EGFP
(Plasmid
#201918)
-
Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD20
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201918 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAddgene #171625
- Total vector size (bp) 11022
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD20
-
SpeciesH. sapiens (human)
-
Insert Size (bp)891
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCCAGCTTGGCACTTGATG
- 3′ sequencing primer CCTCACATTGCCAAAAGACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJRH-1328 LV EF1a-CD20 IRES-EGFP was a gift from Jennifer Doudna (Addgene plasmid # 201918 ; http://n2t.net/addgene:201918 ; RRID:Addgene_201918) -
For your References section:
In vivo human T cell engineering with enveloped delivery vehicles. Hamilton JR, Chen E, Perez BS, Sandoval Espinoza CR, Kang MH, Trinidad M, Ngo W, Doudna JA. Nat Biotechnol. 2024 Jan 11. doi: 10.1038/s41587-023-02085-z. 10.1038/s41587-023-02085-z PubMed 38212493