Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJRH-1328 LV EF1a-CD20 IRES-EGFP
(Plasmid #201918)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 201918 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Addgene #171625
  • Total vector size (bp) 11022
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD20
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    891
  • Promoter EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCCAGCTTGGCACTTGATG
  • 3′ sequencing primer CCTCACATTGCCAAAAGACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJRH-1328 LV EF1a-CD20 IRES-EGFP was a gift from Jennifer Doudna (Addgene plasmid # 201918 ; http://n2t.net/addgene:201918 ; RRID:Addgene_201918)
  • For your References section:

    In vivo human T cell engineering with enveloped delivery vehicles. Hamilton JR, Chen E, Perez BS, Sandoval Espinoza CR, Kang MH, Trinidad M, Ngo W, Doudna JA. Nat Biotechnol. 2024 Jan 11. doi: 10.1038/s41587-023-02085-z. 10.1038/s41587-023-02085-z PubMed 38212493