PCDH-Mut-ALKBH5-3xFLAG
(Plasmid
#203737)
-
PurposeOverexpression of ALKBH5-Mut
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203737 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePCDH
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameALKBH5
-
SpeciesH. sapiens (human)
-
MutationEnzyme Inactive Mutation (H226A)
-
GenBank ID54890
-
Entrez GeneALKBH5 (a.k.a. ABH5, OFOXD, OFOXD1)
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XBAI (unknown if destroyed)
- 3′ cloning site BAMHI (unknown if destroyed)
- 5′ sequencing primer TTTCTCTGGTGTGGTTCTGG
- 3′ sequencing primer AAGTCTTAGTCTTCCCAGGATTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PCDH-Mut-ALKBH5-3xFLAG was a gift from Jianjun Chen (Addgene plasmid # 203737 ; http://n2t.net/addgene:203737 ; RRID:Addgene_203737) -
For your References section:
RNA Demethylase ALKBH5 Selectively Promotes Tumorigenesis and Cancer Stem Cell Self-Renewal in Acute Myeloid Leukemia. Shen C, Sheng Y, Zhu AC, Robinson S, Jiang X, Dong L, Chen H, Su R, Yin Z, Li W, Deng X, Chen Y, Hu YC, Weng H, Huang H, Prince E, Cogle CR, Sun M, Zhang B, Chen CW, Marcucci G, He C, Qian Z, Chen J. Cell Stem Cell. 2020 Jul 2;27(1):64-80.e9. doi: 10.1016/j.stem.2020.04.009. Epub 2020 May 12. 10.1016/j.stem.2020.04.009 PubMed 32402250