pDIV303
(Plasmid #204978)

• Purpose: AMA1 plasmid with Aspergillus optimized Mad7 and amdS selection marker
• Depositing Lab: Uffe Mortensen
• Publication: Vanegas et al J Fungi (Basel). 2022 Dec 22;9(1):16. doi: 10.3390/jof9010016.

Backbone

• Vector backbone: pDIV297
• Total vector size (bp): 15549
• Modifications to backbone: AMA1 element
• Vector type: Bacterial Expression, CRISPR ; Fungal expression
• Selectable markers: amdS

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Mad7
• Species: Synthetic; codon optimized for A. niger
• Insert Size (bp): 3816
• Promoter: Aspergillus nidulans tef1 promoter
• Tag / Fusion Protein:
  • SV40 NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CTTCTCTGCTCAGCACCTCTACG
• 3′ sequencing primer: GCTTTACGGGAAGAGCTGAGAT

Gene/Insert 2

• Gene/Insert name: amdS
• Species: Aspergillus nidulans
• Insert Size (bp): 1647
• Mutation: two silent mutations (nt177T>C, nt879C>T)
• Promoter: Aspergillus nidulans trpC promoter

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GCTAGTGGAGGTCAACACATC

Resource Information

• Supplemental Documents:
  • pDIV303_pAMA1-AmdS+MAD7_PacI_Nt.BbvCI.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry