Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Thy1 promoter construct
(Plasmid #20736)

Loading...
Add to Cart
Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    Thy1 promoter
  • Alt name
    Thy-1.2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    6500
  • GenBank ID
    Ml2379
  • Entrez Gene
    Thy1 (a.k.a. CD90, T25, Thy-1, Thy-1.2, Thy1.1, Thy1.2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site PvuI (unknown if destroyed)
  • 5′ sequencing primer Thy1F1 (TCTGAGTGGCAAAGGACCTTAGG)
  • 3′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Pico Caroni, FMI
  • Terms and Licenses

Depositor Comments

P. Caroni, Overexpression of growth-associated proteins in the neurons of adult transgenic mice. J. Neurosci. Methods 71 (1997), pp. 3–9

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Thy1 promoter construct was a gift from Joshua Sanes (Addgene plasmid # 20736)
  • For your References section:

    Imaging neuronal subsets in transgenic mice expressing multiple spectral variants of GFP. Feng G, Mellor RH, Bernstein M, Keller-Peck C, Nguyen QT, Wallace M, Nerbonne JM, Lichtman JW, Sanes JR. Neuron. 2000 Oct . 28(1):41-51. 10.1016/S0896-6273(00)00084-2 PubMed 11086982