1
Plasmid 20736: Thy1 promoter construct
  • Thy1 promoter

  • Thy-1.2

  • 6500

  • M. musculus (mouse)

  • Ml2379

  • Thy1 (CD90, T25, Thy-1, Thy-1.2, Thy1.1, Thy1.2)

  • pTS(2)
    (Search Vector Database)

  • Mammalian Expression

  • EcoRI

  • Unknown

  • PvuI

  • Unknown

  • Thy1F1 (TCTGAGTGGCAAAGGACCTTAGG) List of Sequencing Primers

  • n/a

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • Pico Caroni, FMI

  • View sequences (1)
  • Joshua Sanes

  • UBMTA

Comments: 

P. Caroni, Overexpression of growth-associated proteins in the neurons of adult transgenic mice. J. Neurosci. Methods 71 (1997), pp. 3–9

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Imaging neuronal subsets in transgenic mice expressing multiple spectral variants of GFP. Feng et al (Neuron. 2000 Oct . 28(1):41-51. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 20736" in your Materials and Methods section.