GW1-mito-mCherryEA
(Plasmid #207868)

• Purpose: Mitochondria-targeted mCherry(I158E/Q160A) mutant as a red fluorescent pH sensor
• Depositing Lab: Mathew Tantama
• Publication: Rajendran et al ACS Omega. 2018 Aug 31;3(8):9476-9486. doi: 10.1021/acsomega.8b00655. Epub 2018 Aug 20.

Backbone

• Vector backbone: GW1
• Backbone size w/o insert (bp): 5273
• Total vector size (bp): 6399
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mito-mCherryEA
• Alt name: mito-mCherry(I158E/Q160A)
• Species: Synthetic
• Insert Size (bp): 1124
• Promoter: CMV
• Tag / Fusion Protein:
  • 4xCox8 mitochondrial targeting (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTGAATCGGAGTGAGTGC
• 3′ sequencing primer: CAAATGTGGTATGGCTGATT

Resource Information

• Supplemental Documents:
  • Addgene207868_p0340_GW1_mito4xCox8_mCherry_I158E_Q160A.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry