pET21a-C2m2-mKate
(Plasmid
#208765)
-
PurposeTo express C2m2-mKate in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208765 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET21a(+)
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5365
- Total vector size (bp) 6624
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC2m2-mKate
-
Alt nameC2 domain
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1259
-
MutationMutated 24 and 45 lysine to asparagine in C2 domain (K24N, K45N), disabling the probe binding to phosphatidylserine
-
GenBank ID17304
-
Entrez GeneMfge8 (a.k.a. MFG-E8, MP47, Mfgm, P47, SED1, lactadherin)
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- mKate (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGGTTGGGAATGTAATTCAG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET21a-C2m2-mKate was a gift from Urte Neniskyte (Addgene plasmid # 208765 ; http://n2t.net/addgene:208765 ; RRID:Addgene_208765) -
For your References section:
Genetically encoded phosphatidylserine biosensor for in vitro, ex vivo and in vivo labelling. Dirvelyte E, Bujanauskiene D, Jankaityte E, Daugelaviciene N, Kisieliute U, Nagula I, Budvytyte R, Neniskyte U. Cell Mol Biol Lett. 2023 Jul 27;28(1):59. doi: 10.1186/s11658-023-00472-7. 10.1186/s11658-023-00472-7 PubMed 37501184