pET21a-C2m2-SNAP
(Plasmid #208773)

• Purpose: To express C2m2-SNAP in bacteria
• Depositing Lab: Urte Neniskyte
• Publication: Dirvelyte et al Cell Mol Biol Lett. 2023 Jul 27;28(1):59. doi: 10.1186/s11658-023-00472-7.

Backbone

• Vector backbone: pET21a(+)
• Backbone manufacturer: EMD Biosciences
• Backbone size w/o insert (bp): 5364
• Total vector size (bp): 6474
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: C2m2-SNAP
• Alt name: C2 domain
• Species: M. musculus (mouse)
• Insert Size (bp): 1109
• Mutation: Mutated 24 and 45 lysine to asparagine in C2 domain (K24N, K45N), disabling the probe binding to phosphatidylserine
• GenBank ID: 17304
• Entrez Gene: Mfge8 (a.k.a. MFG-E8, MP47, Mfgm, P47, SED1, lactadherin)
• Promoter: T7 promoter
• Tag / Fusion Protein:
  • SNAP-tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CGGTTGGGAATGTAATTCAG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGC

Resource Information

• Supplemental Documents:
  • pet21a-c2m2-snap.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry