-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 20918 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBabe
- Backbone size w/o insert (bp) 4500
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameE12
-
Alt nameE2A (E12 isoform)
-
Alt nameTCF3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1971
-
MutationG155D
-
GenBank IDNM_0032002
-
Entrez GeneTCF3 (a.k.a. AGM8, AGM8A, AGM8B, E2A, E47, ITF1, TCF-3, VDIR, bHLHb21, p75)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GATCCTCCCTTTATCCAGCCCTC
- 3′ sequencing primer GGACTTTCCACACCCTAACTGACAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene found a sequence discrepancy resulting in the amino acid change G155D, when compared to Genbank NP_003191. This discrepancy was also present in the original stock of this plasmid and the plasmid should function as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
E12-pCLBabe was a gift from Stephen Tapscott (Addgene plasmid # 20918 ; http://n2t.net/addgene:20918 ; RRID:Addgene_20918) -
For your References section:
MyoD and E-protein heterodimers switch rhabdomyosarcoma cells from an arrested myoblast phase to a differentiated state. Yang Z, MacQuarrie KL, Analau E, Tyler AE, Dilworth FJ, Cao Y, Diede SJ, Tapscott SJ. Genes Dev. 2009 Mar 15. 23(6):694-707. 10.1101/gad.1765109 PubMed 19299559
Map uploaded by the depositor.