Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PGL3-MK17
(Plasmid #21486)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21486 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PGL3 Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4800
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cited2 Promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3440
  • GenBank ID
    AF129290
  • Entrez Gene
    CITED2 (a.k.a. ASD8, MRG-1, MRG1, P35SRJ, VSD2)
  • Tag / Fusion Protein
    • Luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site kpnI (not destroyed)
  • 3′ cloning site xhoI (not destroyed)
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Contains bases -3375 to +65 of cited2 genomic sequence. Constructed by cloning a 2.8kb KpnI/AvrII genomic fragment into the MK14 plasmid

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PGL3-MK17 was a gift from Shoumo Bhattacharya (Addgene plasmid # 21486 ; http://n2t.net/addgene:21486 ; RRID:Addgene_21486)
  • For your References section:

    Molecular cloning and chromosomal localization of the human CITED2 gene encoding p35srj/Mrg1. Leung MK, Jones T, Michels CL, Livingston DM, Bhattacharya S. Genomics. 1999 Nov 1. 61(3):307-13. 10.1006/geno.1999.5970 PubMed 10552932