-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 21496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTransluc (Panomics)
- Backbone size w/o insert (bp) 4800
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name1.5kb 5' of miR-145
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1500
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site Bgl II (not destroyed)
- 5′ sequencing primer ggtaccgagctcttacgcgt sequencing primer sequence (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
Depositor Comments
Plasmid 21496: P-miR-145 (pTransluc-miR-145-1) has a mutation in the miR-145 sequence resulting in A to G mutation. The mutation is a SNP from the human ES cells H9.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
P-miR-145 (pTransluc-miR-145-1) was a gift from Kenneth Kosik (Addgene plasmid # 21496 ; http://n2t.net/addgene:21496 ; RRID:Addgene_21496) -
For your References section:
MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Xu N, Papagiannakopoulos T, Pan G, Thomson JA, Kosik KS. Cell. 2009 May 15. 137(4):647-58. 10.1016/j.cell.2009.02.038 PubMed 19409607