Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

P-miR-145 (pTransluc-miR-145-1)
(Plasmid #21496)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21496 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    1.5kb 5' of miR-145
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1500

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site Bgl II (not destroyed)
  • 5′ sequencing primer ggtaccgagctcttacgcgt sequencing primer sequence
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Plasmid 21496: P-miR-145 (pTransluc-miR-145-1) has a mutation in the miR-145 sequence resulting in A to G mutation. The mutation is a SNP from the human ES cells H9.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P-miR-145 (pTransluc-miR-145-1) was a gift from Kenneth Kosik (Addgene plasmid # 21496)
  • For your References section:

    MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Xu N, Papagiannakopoulos T, Pan G, Thomson JA, Kosik KS. Cell. 2009 May 15. 137(4):647-58. 10.1016/j.cell.2009.02.038 PubMed 19409607