Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

YIPlac204TKC-DsRed-Express2-HDEL
(Plasmid #21770)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21770 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    YIPlac204
  • Backbone size w/o insert (bp) 4000
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DsRed-Express2
  • Alt name
    DsRed
  • Species
    Discosoma sp.
  • Insert Size (bp)
    4985
  • GenBank ID
    FJ226077
  • Tags / Fusion Proteins
    • preKar2 (N terminal on insert)
    • HDEL (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CTACAAAAAACACATACATAAACT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Linearize with EcoRV to direct integration at the TRP1 locus.

Addgene NGS confirms a single silent mutation within the DsRed-Express2 coding sequence compared to the reference sequence provided by the depositing laboratory

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    YIPlac204TKC-DsRed-Express2-HDEL was a gift from Benjamin Glick (Addgene plasmid # 21770 ; http://n2t.net/addgene:21770 ; RRID:Addgene_21770)