1
Plasmid 21718: pDsRed-Max-N1
  • DsRed-Max

  • 678

  • Discosoma sp.

  • FJ226078

  • pDsRed-N1
    (Search Vector Database)

  • Clontech

  • Mammalian Expression

  • 4000

  • BamHI

  • No

  • NotI

  • No

  • cggactcagatctcgagctcaagc List of Sequencing Primers

  • Kanamycin

  • DH5alpha

  • 37

  • Unknown

  • Neomycin

  • View sequences (2)
  • Benjamin Glick

  • MTA
    Clontech Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A noncytotoxic DsRed variant for whole-cell labeling. Strack et al (Nat Methods. 2008 Nov . 5(11):955-7. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21718" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only