Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

mGFP-10-sREACh-N3
(Plasmid #21947)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21947 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    mGFP-C1
  • Backbone manufacturer
    clontech
  • Backbone size w/o insert (bp) 3935
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mGFP-10-sREACh
  • Species
    jellyfish
  • Insert Size (bp)
    1450

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer aaatgggcggtaggcgtgta
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mGFP-10-sREACh-N3 was a gift from Ryohei Yasuda (Addgene plasmid # 21947 ; http://n2t.net/addgene:21947 ; RRID:Addgene_21947)
  • For your References section:

    Highly sensitive and quantitative FRET-FLIM imaging in single dendritic spines using improved non-radiative YFP. Murakoshi H, Lee SJ, Yasuda R. Brain Cell Biol. 2008 Aug . 36(1-4):31-42. 10.1007/s11068-008-9024-9 PubMed 18512154