Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Flag-HA-CYLD
(Plasmid #22544)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 22544 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDEST_LTR_N_FLAG_HA_IRES_puro
  • Backbone manufacturer
    Harper_Lab
  • Backbone size w/o insert (bp) 6521
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CYLD
  • Alt name
    cylindromatosis (turban tumor syndrome)
  • Alt name
    CDMT, CYLD1, CYLDI, EAC, FLJ20180, FLJ31664, HSPC057, KIAA0849, USPL2
  • Species
    H. sapiens (human)
  • Mutation
    None
  • GenBank ID
    NM_015247
  • Entrez Gene
    CYLD (a.k.a. BRSS, CDMT, CYLD1, CYLDI, EAC, MFT, MFT1, SBS, TEM, USPL2)
  • Tags / Fusion Proteins
    • HA (N terminal on backbone)
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site GATEWAY_LR (unknown if destroyed)
  • 3′ cloning site GATEWAY_LR (unknown if destroyed)
  • 5′ sequencing primer CAGCCCTCACTCCTTCTCTAGG
  • 3′ sequencing primer CAAGCGGCTTCGGCCAGTAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    gift from Steve Elledge, HMS
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Flag-HA-CYLD was a gift from Wade Harper (Addgene plasmid # 22544 ; http://n2t.net/addgene:22544 ; RRID:Addgene_22544)
  • For your References section:

    Defining the human deubiquitinating enzyme interaction landscape. Sowa ME, Bennett EJ, Gygi SP, Harper JW. Cell. 2009 Jul 23. 138(2):389-403. 10.1016/j.cell.2009.04.042 PubMed 19615732